View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18237_low_16 (Length: 303)
Name: NF18237_low_16
Description: NF18237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18237_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 288
Target Start/End: Original strand, 12828830 - 12829101
Alignment:
| Q |
17 |
cagttcaacttcaacccataaataatccacttcatttcgtcttacccgaaaatcacgctaacggccacgaaaccgttactaacaacgaaattagttatga |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12828830 |
cagttcaacttcaacccataaatattccacttcatttcgtcttacccgaaaatcacgctaacggccacgaaaccgttactaacaacgaaattagttatga |
12828929 |
T |
 |
| Q |
117 |
acaaggaggtgtagatagcaaaaacgaagggtttattcatcatcctcattcccttctcccatcgccagttccaccggagatatatcaaaccaacaaaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12828930 |
acaaggaggtgtagatagcaaaaacgaagggtttattcatcatcctcattctcttctcccaacgccagttccaccggagatatatcaaaccaacaaaaac |
12829029 |
T |
 |
| Q |
217 |
aacgaatctccgactagcttctccgtcgccggaggaaccatgccggatttcggcacgtttatccgtcaaagg |
288 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829030 |
aacgaatctccgactagcttatccgtcaccggaggaaccatgccggatttcggcacgtttatccgtcaaagg |
12829101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University