View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18237_low_18 (Length: 269)
Name: NF18237_low_18
Description: NF18237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18237_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 4 - 82
Target Start/End: Complemental strand, 36408483 - 36408405
Alignment:
| Q |
4 |
gtgaaaatatcaatttacatttcagtgcttctttcaccgccaagcttcgactcggtctgatcttgtatctgtgctgctc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36408483 |
gtgaaaatatcaatttacatttcagtgcttctttcaccgccaagcttcgactcggtctgatcttgtatctgtgctgctc |
36408405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 176 - 265
Target Start/End: Complemental strand, 26610164 - 26610075
Alignment:
| Q |
176 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggttttg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttg |
26610075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University