View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18238_high_25 (Length: 252)

Name: NF18238_high_25
Description: NF18238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18238_high_25
NF18238_high_25
[»] chr4 (2 HSPs)
chr4 (151-240)||(55245833-55245922)
chr4 (19-82)||(55245705-55245768)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 151 - 240
Target Start/End: Original strand, 55245833 - 55245922
Alignment:
151 gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgtgctc 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
55245833 gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgggctc 55245922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 55245705 - 55245768
Alignment:
19 ctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55245705 ctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt 55245768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University