View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18238_high_25 (Length: 252)
Name: NF18238_high_25
Description: NF18238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18238_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 151 - 240
Target Start/End: Original strand, 55245833 - 55245922
Alignment:
| Q |
151 |
gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgtgctc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55245833 |
gtagtaattggggtatgtatgggcaacagtgtcgagtagctagcattgtggtccttggtacgatctgactcatactctgtgtctgggctc |
55245922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 55245705 - 55245768
Alignment:
| Q |
19 |
ctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245705 |
ctcctcacaattactagggtatgtttttgaataagagttatccatgtagtgctatagtgtaatt |
55245768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University