View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18238_low_29 (Length: 243)
Name: NF18238_low_29
Description: NF18238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18238_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 3945008 - 3945234
Alignment:
| Q |
1 |
tagtcaaatctttacatcaattttcaaatggactcaacttagatataatactatgaatatcaagattggtggaatatttttagacattgaaaattatact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3945008 |
tagtcaaatctttacatcaattttcaaatggactcaacttagatataatactatgaatatcaagattggtggaatatttatggacattgaaaattatact |
3945107 |
T |
 |
| Q |
101 |
ataaattattataaattcttatttgccctaatttgtgttgttatgaattacaatagagat-tgacttttggacaccttttctttctcttctgaaggaaac |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945108 |
ataaataattataaattcttatttgccctaatttgtgttgttatgaattacaatagagatgtgacttttggacaccttttctttctcttctgaaggaaac |
3945207 |
T |
 |
| Q |
200 |
tgagaagagatcgctttatggaaaatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3945208 |
tgagaagagatcgctttatggaaaatc |
3945234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University