View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18238_low_31 (Length: 238)
Name: NF18238_low_31
Description: NF18238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18238_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 21 - 153
Target Start/End: Original strand, 17654908 - 17655044
Alignment:
| Q |
21 |
caccttatcttggattttcaccatctccactcaatggagtccagcctttatcaaaaccaaccctgaccatctcctccaaaggtatttgactattaatttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17654908 |
caccttatcttggattttcaccatctccactcaatggagtccagcctttattaaaaccaaccctgaccgtctcctccaaaggtatttgactattaatttc |
17655007 |
T |
 |
| Q |
121 |
ctttta----ctaactgcaaatataccttcataacaa |
153 |
Q |
| |
|
| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
17655008 |
cctttagtatctaactgtaaatataccttcataacaa |
17655044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University