View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_high_24 (Length: 237)

Name: NF18240_high_24
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_high_24
NF18240_high_24
[»] chr1 (1 HSPs)
chr1 (74-221)||(43570637-43570784)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Original strand, 43570637 - 43570784
Alignment:
74 gtatttaagattgagttcatccacataaatttgcaatgtcgttggctcgcatacatcaacgagatgtatcaccacaacattgtcagaaaagacttttggt 173  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43570637 gtatttaagattgagttcatccacataaacttgcaatgtcgttggctcgcatacatcaacgagatgtatcaccacaacattgtcagaaaagacttttggt 43570736  T
174 gcaacgagtcggtcacttagaggagcctaaactctaggtgatgatcat 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
43570737 gcaacgagtcggtcacttagaggagcctaaactctaggtgatgatcat 43570784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University