View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_low_15 (Length: 351)

Name: NF18240_low_15
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_low_15
NF18240_low_15
[»] chr3 (1 HSPs)
chr3 (1-161)||(45082256-45082414)
[»] chr6 (1 HSPs)
chr6 (194-338)||(22721957-22722103)
[»] scaffold0517 (1 HSPs)
scaffold0517 (194-250)||(4699-4754)
[»] chr1 (1 HSPs)
chr1 (194-250)||(37403322-37403377)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 45082414 - 45082256
Alignment:
1 aattgcgatatttcatgtcagtcgctagaaatctaatctaattaaatcatcaaccctttaatgtctctctctttatttgtacttccatcaaaatgtaaaa 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
45082414 aattgcgatatttcatgtctgtcgctagaaatctaatctaattaaatcatcaaccctttaatgtctctct--ttatttgtacttccatcaaaatgtaaaa 45082317  T
101 tagggggaataacatactattacatttggttatttcagttacttggttgaaaacacccttt 161  Q
    |||||||||||| || |||||| ||||||||||||| ||||| ||||||||||||||||||    
45082316 tagggggaataaaattctattatatttggttatttcggttacgtggttgaaaacacccttt 45082256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 194 - 338
Target Start/End: Original strand, 22721957 - 22722103
Alignment:
194 aatgatgagaataaattgtagccattagattaaaagacaagggctgggattaaaacaacttaaagtgagttgctaatcatgtgattattctctcacttc- 292  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| || |||||||  ||| |||||||||||||||||||||     
22721957 aatgatgagaataaattgtagccattagattaaaagataggggctgggattaaaacaactt-aattgagttgtcaattatgtgattattctctcacttcg 22722055  T
293 ---catcattcacgttcaacgattcaaggtctgtgccttaacccttctt 338  Q
       |||||||||| ||||||| ||||| || ||||||||||||||||||    
22722056 atacatcattcacattcaacggttcaa-gtatgtgccttaacccttctt 22722103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0517 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0517
Description:

Target: scaffold0517; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 194 - 250
Target Start/End: Complemental strand, 4754 - 4699
Alignment:
194 aatgatgagaataaattgtagccattagattaaaagacaagggctgggattaaaaca 250  Q
    |||| ||||||| ||||||||||||||||||||||| |||||| |  ||||||||||    
4754 aatggtgagaatgaattgtagccattagattaaaag-caagggataagattaaaaca 4699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 194 - 250
Target Start/End: Original strand, 37403322 - 37403377
Alignment:
194 aatgatgagaataaattgtagccattagattaaaagacaagggctgggattaaaaca 250  Q
    |||| ||||||| ||||||||||||||||||||||| |||||| |  ||||||||||    
37403322 aatggtgagaatgaattgtagccattagattaaaag-caagggataagattaaaaca 37403377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University