View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_low_21 (Length: 250)

Name: NF18240_low_21
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_low_21
NF18240_low_21
[»] chr1 (2 HSPs)
chr1 (134-240)||(10462859-10462964)
chr1 (1-59)||(10468081-10468139)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 134 - 240
Target Start/End: Complemental strand, 10462964 - 10462859
Alignment:
134 tatttagactccttaatttattggaagagattgaccttgtaaatgtatctcaattaactcgaaagggttaaactccatagttaaacacggagccagagat 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
10462964 tatttagactccttaatttattggaagagattgaccttgtaaatgtatctcaattaactcgaaa-ggttaaactccatagttaaacacggagccagagat 10462866  T
234 acctttg 240  Q
    | |||||    
10462865 atctttg 10462859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 10468139 - 10468081
Alignment:
1 tcagcatactgtgtagaaaaatacctgtatataaagggatattaagtttcgatgtaggg 59  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10468139 tcagcatactgtgtagaaaaatacctgtatataaagggatattaagtttcgatgtaggg 10468081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University