View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18240_low_23 (Length: 241)
Name: NF18240_low_23
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18240_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 47339717 - 47339507
Alignment:
| Q |
13 |
cagagaggttcaacttggcaagaaactgcttggctgcaaggcagtttgctatagcaggagcagcatcaactgtaatatcgtttccactcatctcgagaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47339717 |
cagagaggttcaacttggcaagaaactgcttggctgcaaggcagtttgctatagcaggagcagcatcaactgtaatattgtttccactcatctcgagaac |
47339618 |
T |
|
| Q |
113 |
ttcaaggcaaggagctgatgccttaagagcattagctatagcaattgctccttcgtcttccaagttcaggaagctcaggtatatctcttttaactctgca |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47339617 |
ttcaaggcgaggagctgatgccttaagagcattagctatagcaattgctccttcgtcttccaagttcaggaagctcaggtatatctctcttaactctgca |
47339518 |
T |
|
| Q |
213 |
ttcttggcaag |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
47339517 |
ttcttggcaag |
47339507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University