View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18240_low_24 (Length: 237)
Name: NF18240_low_24
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18240_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Original strand, 43570637 - 43570784
Alignment:
| Q |
74 |
gtatttaagattgagttcatccacataaatttgcaatgtcgttggctcgcatacatcaacgagatgtatcaccacaacattgtcagaaaagacttttggt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43570637 |
gtatttaagattgagttcatccacataaacttgcaatgtcgttggctcgcatacatcaacgagatgtatcaccacaacattgtcagaaaagacttttggt |
43570736 |
T |
 |
| Q |
174 |
gcaacgagtcggtcacttagaggagcctaaactctaggtgatgatcat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43570737 |
gcaacgagtcggtcacttagaggagcctaaactctaggtgatgatcat |
43570784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University