View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18240_low_28 (Length: 222)
Name: NF18240_low_28
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18240_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 41109304 - 41109493
Alignment:
| Q |
14 |
cagagacgaagaaattggcaaaagtcgtaaatgcgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca |
113 |
Q |
| |
|
|||||||| |||| |||||| ||||||| | || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
41109304 |
cagagacggagaagttggcagaagtcgtgactgtgttgcgtggatgtgctcatcaatggtggttttgggggcaccaccatcatccacatgcaagttggca |
41109403 |
T |
|
| Q |
114 |
atcattcgtcactgcctttttgtggcgttttaaaccggaataccgagacgtcttgcctatacctgatgaagaataggagaatgatattca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41109404 |
atcattcgtcactgcctttttgtggcgttttaaaccagaatatcgagacgtcttgcctatacctgatgaagaagaggagcatgatattca |
41109493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 17166795 - 17166606
Alignment:
| Q |
14 |
cagagacgaagaaattggcaaaagtcgtaaatgcgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca |
113 |
Q |
| |
|
|||||||| |||| |||||| ||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17166795 |
cagagacggagaagttggcagaagtcgtgactgtgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca |
17166696 |
T |
|
| Q |
114 |
atcattcgtcactgcctttttgtggcgttttaaaccggaataccgagacgtcttgcctatacctgatgaagaataggagaatgatattca |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||| |||||| |||||||||||||||| |||||| ||||| |||||||||| |
|
|
| T |
17166695 |
atcattcgtcactgcctttttgtggcattttaaaccagaatatcgagacatcttgcctatacctgacgaagaagaggagcatgatattca |
17166606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 85 - 147
Target Start/End: Original strand, 100443 - 100505
Alignment:
| Q |
85 |
caccaccgtcatccacatgcaagttggcaatcattcgtcactgcctttttgtggcgttttaaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| ||| ||||||| |||||||||||||| |
|
|
| T |
100443 |
caccaccgtcatccacatgcaagttgggaaccatttgtcgatgcctttctgtggcgttttaaa |
100505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University