View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18240_low_30 (Length: 205)
Name: NF18240_low_30
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18240_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 2168456 - 2168278
Alignment:
| Q |
15 |
aatcaatactcccaaactcaaattttagtttgatattcacttcatttttaatacatcaaataattcaacaagttaattatctaagcaagattcgaactaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2168456 |
aatcaatactcccaaactcaaattttagtttgatattcacttcatttttaatatatcaaataattcaacaagttaattatctaagcaagattcgaactaa |
2168357 |
T |
 |
| Q |
115 |
ttttgagttaaatagatcataataatcttggttatatatgcatatgtatttattttgtgatatgcacgttttcttttca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2168356 |
ttttgagttaaatagatcataataatcttggttatatatgcatatgtatttattttgtgatatgcacgttttcttttca |
2168278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University