View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18241_high_9 (Length: 241)
Name: NF18241_high_9
Description: NF18241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18241_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 153607 - 153765
Alignment:
| Q |
1 |
taaataaatatgggttatgtcctccgtggtggtgacttgaaaaatgatcatcgtgcttcttctatgccttcttcccattccaaactccttactttaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153607 |
taaataaatatgggttatgtcctccgtggtggtgacttgaaaaatgatcatcgtgcttcttctatgccttcttcccattccaaactccttactttaccca |
153706 |
T |
|
| Q |
101 |
ccattcttactcttgcccgtgtcgcttctattccttttctcgttgccagtgagtcactg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153707 |
ccattcttactcttgcccgtgtcgcttctattccttttctcgttgccagtgagtcactg |
153765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University