View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18242_high_3 (Length: 300)
Name: NF18242_high_3
Description: NF18242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18242_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 25 - 195
Target Start/End: Original strand, 26371650 - 26371820
Alignment:
| Q |
25 |
aataagatgactatgaaagaaaaaatgaaaagcactaagtaattaatgcatgagtcctagttatagaaaaagcatacaacgtggcaaaaaatgaaatgtg |
124 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26371650 |
aataagatgactatgaaaaaaaaaatcaaaagcactaagtaattaatgcatgagtcctagttatagaaaaagcatacaacgtggcaaaaaatgaaatgtg |
26371749 |
T |
|
| Q |
125 |
agcagcagtgtagctaaaaacagaaaacgtgctgtagtgagttttatttcatttcagcatgattgactagt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26371750 |
agcagcagtgtagctaaaaacagaaaacgtgctgtagtgagttttatttcatttcagcatgactgactagt |
26371820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 193 - 253
Target Start/End: Original strand, 26371846 - 26371906
Alignment:
| Q |
193 |
agtaagtctctctttctaaacttcatagcatggctgcagcataacatttctactgcatgag |
253 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26371846 |
agtaagtctctctttttaaacttcatagcatggctgcagcatagcatttctactgcatgag |
26371906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University