View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_113 (Length: 250)
Name: NF18243_high_113
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_113 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 32861959 - 32862197
Alignment:
| Q |
1 |
tcatgggaatggattggctaactttactattccatgactttgataactttaatgtattttgatgatatgattaaaataaattatttatnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861959 |
tcatgggaatggattggctaactttactattccatgactttgataactttagtgtattttgatgatatgattaaaataaattatttatgagagagagaga |
32862058 |
T |
|
| Q |
101 |
nn--caaagttacaaagtcaccatatctcaaatttagccaattttgatccatgtttcgtagcttggcacttacaagggtgtcctaataatgatttgaccc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32862059 |
gagacaaagttacaaagtcaccatatctcaaatttagccaattttgatccatgtttcatagcttggcacttacaagggtgtcctaataatgatttgaccc |
32862158 |
T |
|
| Q |
199 |
tagactggtgtctaccgtcagtgtttgatgtccatgcct |
237 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32862159 |
tagactggtgtctacggtcagtgtttgatgtccatgcct |
32862197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University