View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_114 (Length: 250)
Name: NF18243_high_114
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_114 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 244
Target Start/End: Original strand, 33216229 - 33216466
Alignment:
| Q |
4 |
atgtgagcagattatgacaagctaacctaggatatggatcaaaaggtccatattagcttacgtgaccctgattcaatggatttagggtacgtctatagca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33216229 |
atgtgagcagattatgacaagctaacctaggatatggatcaaaaggtccatattagcttacgtgaccctaattcaatggatttagggtacgtctatagca |
33216328 |
T |
|
| Q |
104 |
tggctcgtctgtgcattatgcgaggatgggcgacttagtctatgaggaaaatgggccttgtccaagtccaaaacaaaatcttgtctcttcttgtgtttat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216329 |
tggctcgtctgtgcattatgcgaggatggacgacttagtctacgaggaaa---ggccttgtccaagtccaaaacaaaatcttgtctcttcttgtgtttat |
33216425 |
T |
|
| Q |
204 |
ctaaaataaatacatctccctattaatatgattcatttcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33216426 |
ctaaaataaatacatctccctattaatatgattcttttcac |
33216466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University