View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_115 (Length: 248)
Name: NF18243_high_115
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_115 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 39 - 248
Target Start/End: Complemental strand, 32579727 - 32579517
Alignment:
| Q |
39 |
cattgaaaacacgtttccattgacatagctagctcccatgtctttttgtcggaaagccttttcctactttgctccaagacttacggaattcaaatgtgag |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32579727 |
cattgaaaacacgtttccattgacatagctagctcccatgtctttttgtcggaaagccttttcctactttgctccaagacttacggaattcaaatgtgag |
32579628 |
T |
|
| Q |
139 |
taatttaggctcacaatttagaaatgaaatattggatatgtaatagaggtgaagtaaaagtctcttat-ggtctggatgttccatccattgtcgctgaca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
32579627 |
taatttaggctcacaatttagaaatgaaatattggatatgtaataaaggtgaagtgaaagtctcttatgggtctggatgttccatccattgccgctgaca |
32579528 |
T |
|
| Q |
238 |
tgcgttgttcc |
248 |
Q |
| |
|
||||||||||| |
|
|
| T |
32579527 |
tgcgttgttcc |
32579517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University