View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_119 (Length: 240)
Name: NF18243_high_119
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_119 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 16513081 - 16513157
Alignment:
| Q |
19 |
gaaggtagtcattctcacttcatgtgcactgtgtccctttcaatatgcatgtctgaatttatttataatgatatata |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16513081 |
gaaggtagtcattctcacttcatgtgcactgtgtctctttcaatatgcatgcctgaatttatttataatgatatata |
16513157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University