View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18243_high_12 (Length: 573)

Name: NF18243_high_12
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18243_high_12
NF18243_high_12
[»] chr5 (1 HSPs)
chr5 (154-331)||(15627500-15627670)
[»] chr7 (1 HSPs)
chr7 (154-256)||(22934064-22934166)
[»] chr1 (3 HSPs)
chr1 (15-57)||(16861859-16861901)
chr1 (63-136)||(7284868-7284944)
chr1 (466-527)||(48019365-48019426)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 154 - 331
Target Start/End: Original strand, 15627500 - 15627670
Alignment:
154 taagcttccattagccgtgacatcgtaaacaagtaggaggtcgcctttacagtgacaccacccaagtaacggaaccaaattccagtggcgaagctggcct 253  Q
    |||||||||||||||| |||  || || |||||||| ||||||||||| ||| ||||||| ||||||| | |||| ||||||| ||| |||||| |||||    
15627500 taagcttccattagccatgaagtcatacacaagtagcaggtcgcctttgcagcgacaccatccaagtagctgaactaaattcctgtgacgaagccggcct 15627599  T
254 atggtggtgatttcagaattcagacacaaattcccccagcttttgttttgattcacgtgaaattttcttaacagctac 331  Q
    ||| ||| |||       ||||||||| |||||||  |||  ||||||||||||| |||||| | |||||||||||||    
15627600 atgctggcgat-------ttcagacacgaattccctaagcccttgttttgattcatgtgaaaatctcttaacagctac 15627670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 6e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 154 - 256
Target Start/End: Complemental strand, 22934166 - 22934064
Alignment:
154 taagcttccattagccgtgacatcgtaaacaagtaggaggtcgcctttacagtgacaccacccaagtaacggaaccaaattccagtggcgaagctggcct 253  Q
    |||||||||||| | | ||| |||||| |||||||||||||||||| | | | ||||||||||||||||| ||||||||||||  ||||||||| |||||    
22934166 taagcttccatttgacatgaaatcgtacacaagtaggaggtcgcctctgcggcgacaccacccaagtaactgaaccaaattccgatggcgaagccggcct 22934067  T
254 atg 256  Q
    |||    
22934066 atg 22934064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 16861901 - 16861859
Alignment:
15 aatatagtcattgaggttcataggaaactcttgtatcaatgct 57  Q
    |||||||||||||||||||||||||||||||| ||||||||||    
16861901 aatatagtcattgaggttcataggaaactcttctatcaatgct 16861859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 63 - 136
Target Start/End: Original strand, 7284868 - 7284944
Alignment:
63 gaggtttagcctgtcaattttacataac---tgagcttatgcaaaaatatgacgtgctaaataaggaataattaagg 136  Q
    ||||||||||||| |||| |||||||||   ||||| |||||  |||| ||| ||||||||||| ||||||||||||    
7284868 gaggtttagcctgccaatgttacataaccaatgagcctatgcggaaatttgaagtgctaaataaagaataattaagg 7284944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 466 - 527
Target Start/End: Original strand, 48019365 - 48019426
Alignment:
466 atgagcagtataaccaatgcagggaaatcaatttcaatacaatctgccaactgcaggaatca 527  Q
    |||| ||| |||||||||||||| | | |||| |||| |||||||||||||| |||||||||    
48019365 atgaccagaataaccaatgcaggaagaccaatctcaacacaatctgccaactacaggaatca 48019426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University