View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_124 (Length: 236)
Name: NF18243_high_124
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_124 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 33216164 - 33215954
Alignment:
| Q |
8 |
aaaggttaactcatagctttttcccaagtacataattgtataccataaatacctcgcatatatgtcacattctgacttgatttcgttagagtgcttgcag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
33216164 |
aaaggttaactcatagctttttcccaagtacataattgtataccataaatacctcgcatatatgtcacattctgacttgat--cgttagagtgtttgcaa |
33216067 |
T |
 |
| Q |
108 |
atacattatcccttcttcgaagaataatgcatatgttgatgaaagatcgtcaactcaaagtcctcaccaccctccacaaaccatagatttcaagtccgag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216066 |
gtacattatcccttcttcgaagaataatgcatatgttgatcaaagatcgtcaactcaaagtcctcaccaccctccacaaaccatagatttcaagtccgag |
33215967 |
T |
 |
| Q |
208 |
catatcatatatg |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33215966 |
catatcatatatg |
33215954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University