View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_125 (Length: 231)
Name: NF18243_high_125
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_125 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 23 - 212
Target Start/End: Complemental strand, 51541508 - 51541319
Alignment:
| Q |
23 |
catctctcatcttcgagacatctttttccttccctttcttgtcatattatttatttcactttcatcttcccttgtttgagagagcagtgcatgtctttca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51541508 |
catctctcatcttcgagacatctttttccttccctttcttgtcatattctttatttcactttcatcttcccttgtttgagagagtagtgcatgtctttca |
51541409 |
T |
 |
| Q |
123 |
cattatgaagacaccaatgacgttaaaaactcacggatgtcttcacattacaagtaccgctgaaatcttttcttcaattttttgcatatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51541408 |
cattatgaagacaccaatgacgttaaaaactcacggatgtcttcacattacaagtaccgctgaaatcttttcttcaattttttgcatatt |
51541319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University