View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_128 (Length: 227)
Name: NF18243_high_128
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_128 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 32579166 - 32579391
Alignment:
| Q |
1 |
ttgcgtgttttttcaactgaggttggcccatatctctcaatcttgtagcctaagaatgacttaagttttgcatgtcacatgagttgttgaggagtccgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32579166 |
ttgcgtgttttttcaactgaggttggcccatatctctcaatcttgtagcctaagaatgacttaagttttgcatgtcacatgagttgttgaggagtccgcg |
32579265 |
T |
 |
| Q |
101 |
gggagcgcaaggagctgcaatagggtaagcgtcttggagtacaacagattttggcgtcacatctttaattctttacccaaaaatcttaaggttatcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
32579266 |
gggagcgcaaggagctgcaatagggtaagcgtcttgaactacaacagattttgacgtcacatctttagttctttacccaaaaatcttaaggttatattct |
32579365 |
T |
 |
| Q |
201 |
agtcgatgttagactaatcactcaca |
226 |
Q |
| |
|
||||||||| |||||| ||||||||| |
|
|
| T |
32579366 |
agtcgatgtgagactagtcactcaca |
32579391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University