View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_135 (Length: 214)
Name: NF18243_high_135
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_135 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 32631166 - 32630969
Alignment:
| Q |
1 |
aggaaacaaaacaaaataactagttacttaggtagtatactcaaacattgaagaaaattattccaccagaaatgaaatatattgcagttaatcatgaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
32631166 |
aggaaacaaaacaaaataactagttacttaggtagtatacttaaacattgaagaagattattccaccagacatgaaatatattccagttaatcatgaacc |
32631067 |
T |
 |
| Q |
101 |
aatctcattttggtgtttggattttgcatattgtagatatttggtgcatgccaatggtatttgtgctgggtattcactattctcagcagtctttgttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
32631066 |
aatctcattttggtgtttggattttgcatattgtaggtatttggtgcatgccaatggtatttgtgcaggatattcactattctcagcagtcattgttg |
32630969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University