View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_54 (Length: 391)
Name: NF18243_high_54
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 378
Target Start/End: Complemental strand, 30436603 - 30436234
Alignment:
| Q |
11 |
gagatgaagaggaatatggcgataaatgtttgtgattcgtcacacttatcggctcctgattctctttttaccgaacatcctgcagcttcagactctatct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30436603 |
gagatgaagaggaatatggcgataaatgtttgtgagtcgtcacacttatcagctcctgattctctttttaccgaacatcctgcagcttcagactctatct |
30436504 |
T |
|
| Q |
111 |
tgtggaaatctggcaataaccaatttcagctgcaaccaagatagagtcgtgcttgcgagccatgtggatttcaaaatttctttgagcgactcctc--gtg |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30436503 |
tgtggaaaactggcaataaccaatttcagatgcaaccaagatagagtcgtgcgtgcgagccatgtggatttcaaaatttctttgagcgactcctcgtgtg |
30436404 |
T |
|
| Q |
209 |
ggagtattgatgtggcagactggcagtagcattttctgcacaaaacaaaatgttaagagaacatgattttgcattgctcgaatacagcgctggaaaaggt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30436403 |
ggagtattgatgtggcagactggcagtagcattttctgaacaaaacaaaatgttaagagaacatgattttgtattgctcgaatacagcgctggaaaaggt |
30436304 |
T |
|
| Q |
309 |
agtgatgtttgcaattaatcacttggtcatgtgagnnnnnnnctgaggttgttgcacactactcaaaaat |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
30436303 |
agtgatgtttgcaattaatcacttggtcatgtgagaaaaaaactgaggttgttgcacactactaaaaaat |
30436234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University