View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_high_99 (Length: 268)
Name: NF18243_high_99
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_high_99 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 42339997 - 42340244
Alignment:
| Q |
18 |
ggatccattgttattgtcttggtaaaaacaagacctctttttgatgtggaagaaggtgtggttaaggtttgatgagtgaaccaagaatgagggaagaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42339997 |
ggatccattgttattgtcttggtaaaaacaagacctctttttgatgtggaagaaggtgtggttaaggtttgatgagtgaaccaagaatgagggaagaagg |
42340096 |
T |
|
| Q |
118 |
ttataagtttcttaggaacaagactaatgagaaatgaattgacaacgttgtataaaaggaaaattctaagcaaaatagttggcatttctaacaaggaagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340097 |
ttataagtttcttaggaacaagactaatgagaaatgaattgacaacgttgtataaaaggaaaattctaagcaaaatagttggcatttctaacaaggaagc |
42340196 |
T |
|
| Q |
218 |
gagtaatttgtagtattgtttaggacttatgttgctggtggtggtggt |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
42340197 |
gagtaatttgtagtattgtttatgacttatgttgctgttggtgttggt |
42340244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University