View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_121 (Length: 243)
Name: NF18243_low_121
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_121 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 22 - 130
Target Start/End: Complemental strand, 12546843 - 12546735
Alignment:
| Q |
22 |
tgaaggttaacctatggttatcttgtaacaatgctcttttctactgtttcttaattgaattgaatatcattttcctaagatctttgttaataattgtcaa |
121 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
12546843 |
tgaaggttaacccatggttatcttgtgacaatgctctgttctactgtttcttaattgaattgaatatcattttcctatgttctttgttaataattgtcaa |
12546744 |
T |
 |
| Q |
122 |
ttttatttg |
130 |
Q |
| |
|
||||||||| |
|
|
| T |
12546743 |
ttttatttg |
12546735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University