View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_125 (Length: 239)
Name: NF18243_low_125
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_125 |
 |  |
|
| [»] scaffold0474 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0474 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 224
Target Start/End: Complemental strand, 8862 - 8659
Alignment:
| Q |
22 |
attcaaagtatgtgtttctttgcataatcttattt-ctttctccatttttgtttgaaaaacatatagaccaccaaccatgtatgtttatatattgctaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8862 |
attcaaagtatgtgtttctttgcataatcttattttctttctccatttttgtttgaaaaacatatagaccaccaaccatgtatgtttatatattgctaga |
8763 |
T |
 |
| Q |
121 |
tatatcaaaactcagatctctggagatccttgaattgtttgggaacaatttgaacttatggcccctaggtttgttgattttcatttgataatttctggtc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8762 |
tatatcaaaactcagatctctggagatccttgaattgtttgggaacaatttgaacttatggcccctaggtttgttgattttcatttgataatttctggtc |
8663 |
T |
 |
| Q |
221 |
tctg |
224 |
Q |
| |
|
|||| |
|
|
| T |
8662 |
tctg |
8659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 46 - 171
Target Start/End: Complemental strand, 24260197 - 24260072
Alignment:
| Q |
46 |
taatcttatttctttctccatttttgtttgaaaaacatatagaccaccaaccatgtatgtttatatattgctagatatatcaaaactcagatctctggag |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||| || ||| ||||| |
|
|
| T |
24260197 |
taatcttatttctttctccatttttgtttgaaaaacatatagacctccaatcatgtatgtttatatgttgctagatatatcaaaactgaggtctttggag |
24260098 |
T |
 |
| Q |
146 |
atccttgaattgtttgggaacaattt |
171 |
Q |
| |
|
|||||||| || | | |||||||||| |
|
|
| T |
24260097 |
atccttgacttatcttggaacaattt |
24260072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 46 - 223
Target Start/End: Complemental strand, 24260560 - 24260378
Alignment:
| Q |
46 |
taatcttatttctttctccatttttgtttgaaaaacatatagaccaccaaccatgtatgttt----atatattgctagatatatcaaaactcagatctct |
141 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||| ||||| |||||||||| || ||| | |||||||||||||||| || ||| | |
|
|
| T |
24260560 |
taatcttatttttttctcggtttttgtttgaaaaccatatagacaaccaatgatgtatgttttatcatgtatcgatagatatatcaaaactgaggtcttt |
24260461 |
T |
 |
| Q |
142 |
ggagatccttgaattgtttgggaacaatttgaacttatggcccctaggtttgttg-attttcatttgataatttctggtctct |
223 |
Q |
| |
|
|||||||||||| || | | |||||| ||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
24260460 |
ggagatccttgacttatcttcaaacaatatgaacttatggaccctaggtttgttgtcatctcatttgataatttctggtctct |
24260378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University