View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_135 (Length: 227)
Name: NF18243_low_135
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_135 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 14441296 - 14441493
Alignment:
| Q |
17 |
agcaaaaatggataaattagctaatatgtatagttttaaatcgtggtccacaatcatagaacccctatataatcagataa-----caactaatcataact |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
14441296 |
agcaaaaacggataaattagctaatatgtatagttttaaatcgtggtccacaatcatagaacccctatataatcaaatcaaatagcaactaatcataact |
14441395 |
T |
|
| Q |
112 |
aatttgaaactatattaaataatattaaacaaactcgaacaaatctccaactatatctaacagtttctgcaagattgcaactgcgatcttagagactc |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14441396 |
aatttgaaactatattaaataatattgaacaaactcgaacaaatctccaactatatctaacagtttctgcaagattgcaactgcgatcttagagactc |
14441493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University