View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_136 (Length: 222)
Name: NF18243_low_136
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_136 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 43792714 - 43792856
Alignment:
| Q |
1 |
taattcagtaacaacaacttgcttctttaatctcaaaatggaagccatggaaaatgcaaatatataaaatgtttaaatcttaagattggtttcttagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792714 |
taattcagtaacaacaacttgcttctttaatctcaaaatggaagccatggaaaatgcaaatatataaaatgtttaaatcttaagattggtttcttagctt |
43792813 |
T |
 |
| Q |
101 |
tgaggagcaattatattactggcacatcatacaatgctgactt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792814 |
tgaggagcaattatattactggcacatcatacaatgctgactt |
43792856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 43792946 - 43792995
Alignment:
| Q |
154 |
ctttcctggtgttaagaggctatatcaatatttgtaaataaaaaagggat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792946 |
ctttcctggtgttaagaggctatatcaatatttgtaaataaaaaagggat |
43792995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University