View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_14 (Length: 551)
Name: NF18243_low_14
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 265 - 536
Target Start/End: Original strand, 36097341 - 36097621
Alignment:
| Q |
265 |
ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttggtgatcattcatccctgtgcattctttctattcccccctt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36097341 |
ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttggtgatcattcatccttgtgcattcgttctattcccccctt |
36097440 |
T |
 |
| Q |
365 |
ttctatatagatatttgtagtttaaaaacaaataac-aag--------gtcaaatggttaatgagctctatcaaaggacaaattgtaaaagagagtatga |
455 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097441 |
ttctacatggatatttgcagtttaaaaacaaataacgaagcaattgaagtcaagtggttaatgagctctatcaaaggacaaattgtaaaagagagtatga |
36097540 |
T |
 |
| Q |
456 |
gtttgctttttggatggaacaatttttggcaaatcttttcttacctcccgaccgagctctaaattattattgccccctttg |
536 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36097541 |
gtttgctttttggatggaacaattcttggcaaaccttttcttacctcccgaccgagctctaaattactattgccccctttg |
36097621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 36097090 - 36097271
Alignment:
| Q |
20 |
actatgagttgatagtggaaccatttctcttttggagtcggtagcctttctctacaagggcgttggttgggaacctttgagcgaggtccttggtatattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097090 |
actatgagttgatagtggaaccatttctcttttggagtcggtagcctttctctacatgggcgttggttgggaacctttgagcgaggtccttggtatattt |
36097189 |
T |
 |
| Q |
120 |
cttgattttttgtgtctcatctctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097190 |
cttgattttttgtgtctcatttctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg |
36097271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 11649907 - 11649863
Alignment:
| Q |
22 |
tatgagttgatagtggaaccatttctcttttggagtcggtagcct |
66 |
Q |
| |
|
||||||| ||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
11649907 |
tatgagtggatggtggaaccacttctcttttggagttggtagcct |
11649863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University