View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_143 (Length: 208)
Name: NF18243_low_143
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_143 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 5432783 - 5432602
Alignment:
| Q |
14 |
tcataggaaacagcatgttgagatcattccaaacgaccaaggaaacagcatgatcccttatattacgtcgactccactgaaaccagttttaatgcaatga |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5432783 |
tcataggaaacagcctgttgagatcattccaaacgaccaaggaaacagcatgatcccttatattacgtcgactccactgaaaccagttttaatgcgatga |
5432684 |
T |
|
| Q |
114 |
gtatcgacactaagcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaatgtact |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
5432683 |
gtatcgacactaagcctactgtagctgttattgctaatactttggataggaaaatgtggagagaaggtgagacgaatgtact |
5432602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 126 - 192
Target Start/End: Original strand, 5445649 - 5445715
Alignment:
| Q |
126 |
agcctactgcagctgttattgctaatagtttggataggaaaaagtggagagaagatgagacgaatgt |
192 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||| | ||||| ||||||||||| ||||| |||||| |
|
|
| T |
5445649 |
agcctactgcagctgctattgcttatggtttggacaagaaaatgtggagagaaggtgagaagaatgt |
5445715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University