View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_43 (Length: 427)
Name: NF18243_low_43
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 6 - 412
Target Start/End: Original strand, 56277906 - 56278312
Alignment:
| Q |
6 |
caaagggttatacataggaggtgtcttgcattggcttacagaaggtgatcaaatcatcacctttaatcttgaaaaggaactgtctttgatgatttcagta |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56277906 |
caaagggttatacataggaggtgtcttgcattggcttacagaaggtgatcaaatcatcacctttaatgttgaaaaggaactgtctttgatgatttcagta |
56278005 |
T |
 |
| Q |
106 |
cctgttcctgcatgtgagtttaggaccgtccctcaagcttgcattggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcatg |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278006 |
cctgttccggcatgtgagtttaggaccgtccctcaagcttgcattggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcatg |
56278105 |
T |
 |
| Q |
206 |
tctggtgtcttgattctcttgaagattattttgacttcaaatggctgcttaagcattgcaaacttttggaggattttgaagcagaatatccacgcctctt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278106 |
tctggtgtcttgattctcttgaagattattttgacttcaaatgggtgcttaagcattgcaaacttttggaggattttgaagcagaatatccacgcctctt |
56278205 |
T |
 |
| Q |
306 |
tttgaatctaaggaatagagtgttggagagtgatgatacaaatccttggatgaatcctcttggcttcaaagatgggaaattgctgattaaggtttctgca |
405 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278206 |
tttgaatttaaggaatagagtgttggagagtgatgatacaaatccttggatgaatcctcttggcttcaaagatgggaaattgctgattaaggtttctgca |
56278305 |
T |
 |
| Q |
406 |
gagttat |
412 |
Q |
| |
|
||||||| |
|
|
| T |
56278306 |
gagttat |
56278312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University