View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_76 (Length: 341)
Name: NF18243_low_76
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 46776354 - 46776210
Alignment:
| Q |
1 |
gaagagaaaactaggtggtttggaaacattgaaacaccaaaataatgaaactattctcggttatgtccgactcgaataatttatctttacagttgtatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
46776354 |
gaagagaaaactaggtggtttggaaacattgaaacaccaaaataataaaactattcttggttatatccgactcgaataatttatctttacagttgtacgt |
46776255 |
T |
|
| Q |
101 |
agatgataaaattaatttttgcaattgcacacagggatacttgtt |
145 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
46776254 |
agatgataaaattaatttttgtaattgcacgcagggatacttgtt |
46776210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 218 - 324
Target Start/End: Complemental strand, 46776134 - 46776028
Alignment:
| Q |
218 |
cagaattgcgtgaatagtttataaataattctgcaaaatcgtggatggttaattaaccattcattcccctgttcaaaaaatatcaattatacttctttct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46776134 |
cagaattgcgtgaatagtttataaataattctgcaaaatcgtgaatggttaattaaccattcattcccctgttcaaaaaatatcaattatacttctttct |
46776035 |
T |
|
| Q |
318 |
atcttat |
324 |
Q |
| |
|
|||||| |
|
|
| T |
46776034 |
ctcttat |
46776028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 3917340 - 3917373
Alignment:
| Q |
15 |
gtggtttggaaacattgaaacaccaaaataatga |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
3917340 |
gtggtttggaaactttgaaacaccaaaataatga |
3917373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University