View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_77 (Length: 340)
Name: NF18243_low_77
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 36756931 - 36756659
Alignment:
| Q |
19 |
tgcacagtgtttaatttcccggtggcatgtcattaaacatgcttttgtttgaactacatgaggtagattttacttccaccgtggaaacaagagtttccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36756931 |
tgcacagtgtttaatttcccggtggcatgtcattaaacatgcgtttgtttgaactacatgaggtagattttacttccaccgtggaaacaagagtttccaa |
36756832 |
T |
|
| Q |
119 |
acagctaactggtctaaccgtgtatatctcatcaagataatgatatatcgatgactctatttactatgcgggtttgagattttacagcatattatggctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36756831 |
acagctaactggtctaaccgtgtatatctcatcaagataatgatttattgatgactctatttactatgcgggtttgagattttacagcgtattatggctg |
36756732 |
T |
|
| Q |
219 |
aaccttcctcaccaggataccgtagcagagttggttttggagactgaacttcttcatgtgcttgaagtagtag |
291 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36756731 |
aaccttcttcaccaggataccgtagcagagttggttttggagactgaacttcttcatgtgcttgaagaagtag |
36756659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University