View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18243_low_95 (Length: 278)
Name: NF18243_low_95
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18243_low_95 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 6406524 - 6406262
Alignment:
| Q |
18 |
aagaaatcatgtttttcaactcttccattatgatgagatctggtga--gagttgattatcataatgtatcagtcatgaatcatgataagatattattttg |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6406524 |
aagaaatcatgtttttctactcttccattatgatgtgatctggtgatagagttgattatcataatgtatcagtcatgaatcatgataagatattattttg |
6406425 |
T |
 |
| Q |
116 |
attgagcaacaatatatgctgtgctaaaattggaatagtggcagttacctatagtagaaaatttaattataagtcatcattagcatgaagaagataggca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6406424 |
attgagcaacaatatatgctgtgctaaaattggaatagtggtagttacctatagtagaaaatttaattataagtcatcattagcatgaagaagataggca |
6406325 |
T |
 |
| Q |
216 |
agatgaaccctgtccaccttaagttggagattcatattcatcgtagtaattcaaccctttgtt |
278 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6406324 |
agatgaaccctgtccacctcaagttggagattcatattcatcgtagtaattcaaccctttgtt |
6406262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University