View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18244_high_13 (Length: 394)
Name: NF18244_high_13
Description: NF18244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18244_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 383
Target Start/End: Complemental strand, 39667688 - 39667328
Alignment:
| Q |
20 |
tttacaaccttattgcttttgttttcatcaccatcatcattgttattgtgttacacgttcnnnnnnnnnnnnnnnnnnnnnctcatatactactcatttt |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39667688 |
tttacaaccttattgtttttgttttcatcaccatcatcattgttattgtgttacacgttcattattattatattattatatctcatatactactcatttt |
39667589 |
T |
|
| Q |
120 |
ttatcacaaccatgatgatattgtttgtgattctttcagggtatgttgtagtagagaagaaacaagattattgaatattcaagagattgatttgattcca |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39667588 |
ttgtcacaaccatgatgatattgtttgtgattctttcagggtatgt---agtagagaagaaacaagattattgaatattcaagagattgatttgattcca |
39667492 |
T |
|
| Q |
220 |
caaaaaacacaaacatgtcttctttagattcaacttggatcacatctctttcatgttcaccttcttcaggtgatgctgttgctgcatatgcattacctca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39667491 |
caaaaaacacaaacatgtcttctttagattcaacttggatcacatctctttcatgttcaccttcttcaggtgatgctgttgctgcatatgcattacctca |
39667392 |
T |
|
| Q |
320 |
atggttgagattcattttcctctcaccatgtcctcaaagagctcttctttcagctgatgatgtc |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
39667391 |
atggttgagattcattttcctctcaccatgtcctcaaagagctcttctttcagccgttgatgtc |
39667328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University