View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18244_low_20 (Length: 319)
Name: NF18244_low_20
Description: NF18244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18244_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 39479064 - 39479402
Alignment:
| Q |
1 |
attttgcttttgtggttgaatattgttgaggtttctcgtaagggtaatgatattgatttttctgttgggattacttctgctggttttggagttgagaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479064 |
attttgcttttgtggttgaatattgttgaggtttctcgtaagggtaatgatattgatttttctgttgggattacttctgctggttttggagttgagaatt |
39479163 |
T |
 |
| Q |
101 |
tccttgaatgccctcagtgtggttgtgggtttgattgcaataatattctgaggttaaacggtgatgttcaagtttcttcaatttagg----------ttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39479164 |
tccttgaatgccctcagtgtggttgtgggtttgattgcaataatattctgaggttaaacggtgatgttcaagtttcttcaatttaggttttattgtattt |
39479263 |
T |
 |
| Q |
191 |
tattgtatcattcaatttcggaa---att-------gaacttttctgttgaagattttagatctatctctatttatcttctttgttttatgctttttgga |
280 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39479264 |
tattgtatcattcaatttcggaatggattattgaacgaacttttctgttgaagattttagatctatatctatttatcttctttgttttatgctttttgga |
39479363 |
T |
 |
| Q |
281 |
attgaaattcagtaataataataggtgaattttttgagg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479364 |
attgaaattcagtaataataataggtgaattttttgagg |
39479402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 278
Target Start/End: Complemental strand, 55179216 - 55179154
Alignment:
| Q |
217 |
gaacttttctgttgaagattttagatctatctctatttatc-ttctttgttttatgctttttg |
278 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
55179216 |
gaacttttctgttgaagattgtatatctatctctatttatctttctttgttttatgttttttg |
55179154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University