View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18244_low_32 (Length: 242)
Name: NF18244_low_32
Description: NF18244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18244_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 160 - 226
Target Start/End: Complemental strand, 5796601 - 5796535
Alignment:
| Q |
160 |
cttaacttaatatattgaataaattggtttatattgaaatttatttgatactatggatctgtgttgt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5796601 |
cttaacttaatatattgaataaattggtttatattgaaatttatttgatactatggatctgtgttgt |
5796535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University