View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18245_high_7 (Length: 340)
Name: NF18245_high_7
Description: NF18245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18245_high_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 340
Target Start/End: Complemental strand, 48696129 - 48695792
Alignment:
| Q |
11 |
gaacctgtggtggagatgtaatttctgtaaacgattatgtagtttgaatcacctgctttaacagcacagcacaacagtcacataatggaaagactctaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48696129 |
gaacctgtggtggagatgtaatttctgtaaacgattatgtagtttgaatcacctgctttaacagcacagcacaacagtcacataatggaaagactctaaa |
48696030 |
T |
|
| Q |
111 |
ctgtttaacttaacagttactacttgttttgtgagagatttgatttgcttgggggtatcattcggaaacttgaatccacttgttttgaaagattatttct |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48696029 |
ctgtttaacgtaacagttactacttgttttgtgagagatttgatttgcttgggggtatcatttggaaacttgaatccacttgttttgaaagattatttct |
48695930 |
T |
|
| Q |
211 |
atttgcacgcaaaaccttgagagaagatgatgtcttgcttgatggcaaagagtgcacttgtatggcccgtgtgtgagtgagagag--------agagggc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48695929 |
atttgcacgcaaaaccttgagagaagatgatgtcttgcttgatggcaaagagtgcacttgtatggcccgtgtgtgagtgagagagagagagagagagggc |
48695830 |
T |
|
| Q |
303 |
caagaagacggtggtcacagacagaagacagtaccatt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695829 |
caagaagacggtggtcacagacagaagacagtaccatt |
48695792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University