View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18246_low_5 (Length: 286)
Name: NF18246_low_5
Description: NF18246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18246_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 28235619 - 28235368
Alignment:
| Q |
16 |
ataaaattgggacattttagcctatatctcaatctatgtnnnnnnntggattttttaaaa-ttgatatgtgacgtcttaatcccatcatgtgagtatatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28235619 |
ataaaattgggacattttagcctatatctcaatctatatgaaaaaatggattttttaaaaattgatatgtgacgtcttaatcc-atcatgtgagtatatt |
28235521 |
T |
|
| Q |
115 |
cactgtcaccatattaggtatgtgtcatgtccctgaattaaatatcaatatagtgttcataataattccaaatgaacattttagttcatatagcgattta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28235520 |
cactgtcaccatattaggtatgtgtcatgtccctgaattaaatatcaatatagtgttcataataattccaaatgaacattttagttc--atagcgattta |
28235423 |
T |
|
| Q |
215 |
aattcttagattttgtgttatcactcaaccacttcaataatatttaccaattaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28235422 |
aattcttagattttgtgttatcactcaaccacttcaataatatttaccaattaat |
28235368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University