View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18247_high_11 (Length: 259)
Name: NF18247_high_11
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18247_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 131 - 243
Target Start/End: Complemental strand, 44081373 - 44081255
Alignment:
| Q |
131 |
atatgctattcacatcacttcaatctttcttctcttctcagtaaatccaaatat------attcaatttgttttttcaattgccttcaacaccttcattc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44081373 |
atatgctattcacatcacttcaatctttcttctcttctcagtaaatccaaatatctattcattcaatttgttttttcaattgtcttcaacaccttcattc |
44081274 |
T |
|
| Q |
225 |
acaattccgctttagaact |
243 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
44081273 |
acaattccgctttaaaact |
44081255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 44081491 - 44081434
Alignment:
| Q |
13 |
catcactgtttggacggatttcttccttttcttctcttctctgtaaatccaaatacct |
70 |
Q |
| |
|
||||||||| | |||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
44081491 |
catcactgtctagacggatttcttcctttttttctcttctctttaaatccaaatacct |
44081434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 19266141 - 19266194
Alignment:
| Q |
14 |
atcactgtttggacggat-ttcttccttttcttctcttctctgtaaatccaaat |
66 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19266141 |
atcactgtgtgtacggatcttcttccttttcttctcttctctgtaaatccaaat |
19266194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 67
Target Start/End: Original strand, 32375208 - 32375243
Alignment:
| Q |
32 |
ttcttccttttcttctcttctctgtaaatccaaata |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32375208 |
ttcttccttttcttctcttctctgtaaatccaaata |
32375243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University