View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18247_high_17 (Length: 239)
Name: NF18247_high_17
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18247_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 76 - 221
Target Start/End: Complemental strand, 48857153 - 48857012
Alignment:
| Q |
76 |
gcaagaaacagaccaacatttatttatttatagacacgacgacatgaaatgttgctgagccaaaacctcaacttctggccacgtcatgatatcaccggag |
175 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857153 |
gcaagaaacagaccaac----gtttatttatagacacgacgacatgaaatgttgctgcgccaaaacctcaacttctggccacgtcatgatatcaccggag |
48857058 |
T |
|
| Q |
176 |
caactccacgacgaatcactctccatcagctccggcaattcaatct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857057 |
caactccacgacgaatcactctccatcagctccggcaattcaatct |
48857012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University