View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18247_low_16 (Length: 240)
Name: NF18247_low_16
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18247_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 31444794 - 31444938
Alignment:
| Q |
18 |
atgtatgacttaaacattaggataacatatacagttgccaaaatatgcaagcctaaggagttaattcatgtttttattttgaaatgtgcaggtttgaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31444794 |
atgtatgacttaaacattaggataacatatatagttgccaaaatatgcaaacctaaggagttaattcatgttttaattttgaaactggcaggtttgaatt |
31444893 |
T |
 |
| Q |
118 |
cctcttcatatgtgcttctaaattctaggactgatgatgaattca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31444894 |
cctcttcatatgtgcttctaaattctaggactgatgatgagttca |
31444938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 31445223 - 31445269
Alignment:
| Q |
175 |
aaaaatatggtttattgtgaggactaattgttcttttaactttgtta |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31445223 |
aaaaatatggtttattgtgatgactaattgttcttttaactttgtta |
31445269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University