View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18247_low_17 (Length: 240)
Name: NF18247_low_17
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18247_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 24727019 - 24727232
Alignment:
| Q |
1 |
aaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24727019 |
aaaaacaatgaaacgtcctctctcttcctccatcctctgccttccttatttctccaagtccccactccgtcgttccctctcctccaccaccaccatccct |
24727118 |
T |
 |
| Q |
101 |
cttctgtctccggtgacggcggcggtgactaccaaaaa-ccccctttgtctcacccgcaaccaccattggccgctgccatggcctccctcactctccctc |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
24727119 |
cttctgtctccggtgacggcgg------ctaccaaaaacccccctttgtctcacccgcaaccaccattggctgctgccatggcctctctcactctccctc |
24727212 |
T |
 |
| Q |
200 |
atcaaacatccttgtcatct |
219 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
24727213 |
gtcaaacatccttgacatct |
24727232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University