View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18247_low_19 (Length: 226)
Name: NF18247_low_19
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18247_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 58 - 209
Target Start/End: Original strand, 8737839 - 8737990
Alignment:
| Q |
58 |
tcaacacataagaaaaacagcggcacacaacggtttataatagcttactatccaattgataactgcgtacggttccttctcttcatgataatttttcaac |
157 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8737839 |
tcaacacagaagaaaaacagcggcacacaacggtttgtaatagcttactatccaattgataactgtgtacggttccttctcttcatgataatttttcaac |
8737938 |
T |
 |
| Q |
158 |
tatgcaatcacattgaatacacaaacgtgtgagtatcttcttatgttcacat |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8737939 |
tattcaatcacattgaatacacaaacgtgtgagtatcttcttatgttcacat |
8737990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University