View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_high_10 (Length: 359)
Name: NF18249_high_10
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 4 - 174
Target Start/End: Complemental strand, 25544507 - 25544331
Alignment:
| Q |
4 |
tcattttctcaaattattatacgtgtcggtgtcggtg------cttaatagcatagaaccgcatcatctgaaatagtgagaattcagagagatgcaaatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25544507 |
tcattttctcaaattattatacgtgtcggtgtcggtgtccgtgcttaatagcatagaaccgcctcatctgaaatagtgagaattcagagagatgcaaatg |
25544408 |
T |
 |
| Q |
98 |
caataatctctgtctattaatggagagaaagaaacggatctactacctgattgagaatgctatcaaaagtcttcccc |
174 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25544407 |
caacaatctctgtctattaatggagagaaagaaacggatctactacctgattgagaatgctatcaaaagtcttcccc |
25544331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 4 - 37
Target Start/End: Complemental strand, 23440036 - 23440003
Alignment:
| Q |
4 |
tcattttctcaaattattatacgtgtcggtgtcg |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23440036 |
tcattttctcaaattattatacgtgtcggtgtcg |
23440003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 40747803 - 40747838
Alignment:
| Q |
1 |
atgtcattttctcaaattattatacgtgtcggtgtc |
36 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40747803 |
atgtcattttctcaaattattatccgtgtcggtgtc |
40747838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 186
Target Start/End: Original strand, 36162771 - 36162826
Alignment:
| Q |
130 |
aacggatctactacctgattgagaatgctatcaaaagtcttccccttttcttcttct |
186 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
36162771 |
aacgaatctagtacctgaatgagaatgctatcaaaaatctt-cccttttcttcttct |
36162826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 13009529 - 13009565
Alignment:
| Q |
7 |
ttttctcaaattattatacgtgtcggtgtcggtgctt |
43 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
13009529 |
ttttctcaaattattatccgtgtcggtgtccgtgctt |
13009565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 29812697 - 29812729
Alignment:
| Q |
4 |
tcattttctcaaattattatacgtgtcggtgtc |
36 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29812697 |
tcattttctcaaattattatacgggtcggtgtc |
29812729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 32910580 - 32910548
Alignment:
| Q |
1 |
atgtcattttctcaaattattatacgtgtcggt |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
32910580 |
atgtcattttctcaaattattatccgtgtcggt |
32910548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University