View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_low_12 (Length: 359)
Name: NF18249_low_12
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 12 - 341
Target Start/End: Complemental strand, 51964813 - 51964484
Alignment:
| Q |
12 |
atgaatggggtttaaagtcgaggttgtaggctgttgataaatacaaaggccaactgattgtaagattgaaagcgtttcatggtccgtctcaatcagcaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964813 |
atgaatggggtttaaagtcgaggttgtaggctgttgataaatacaaaggccaactgattgtaagattgaaagcgtttcatggtccgtctcaatcagcaag |
51964714 |
T |
|
| Q |
112 |
cttagcttcctctgtttgacaacaaattttcagctactttgtgcaaaataaataagagaggggggaaatttaattaaggtagtttgcatcaaaacaggat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964713 |
cttagcttcctctgtttgacaacaaattttcagctactttgtgcaaaataaataagagagaggggaaatttaattaaggtagtttgcatcaaaacaggat |
51964614 |
T |
|
| Q |
212 |
cttaagtagagagcacagttgtggagcccaataagtgtctcagttgtctaatccatcaccatctaggcatttgtgattcttggcagaccttgtgttcttt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51964613 |
cttaagtagagagcacagttgtggagcccaataagtgtcccagttgtctaatccatcactatctaggcctttgtgattcttggcagaccttgtgttcttt |
51964514 |
T |
|
| Q |
312 |
tggttttacttagctagataccacataaac |
341 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
51964513 |
tggttttacttagctagctaccacataaac |
51964484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University