View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_low_16 (Length: 290)
Name: NF18249_low_16
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_low_16 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0790 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 21 - 275
Target Start/End: Original strand, 946 - 1202
Alignment:
| Q |
21 |
ttttgtgcaaatgttttgttcttttgcggaaaagaaacttgatatttgttttaactctttgttcccctgaaccctaattaaataaaaaggaagaaaa--- |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
946 |
ttttatgcaaatgttttgttcttttgcggaaaagaaacttaat---tgttttaactctttgttcccctgaaccataattaaataaaaaggaagaaaataa |
1042 |
T |
 |
| Q |
118 |
ggtaatttttgttgtgaggatggaaaccacgttgtgattcataggtttatcgaaactttaagttaaacctccgtgtcattctgaattttcctatatatcg |
217 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| | |
|
|
| T |
1043 |
ggtaaattttgttgtgagaatggaaaccacgttgtgattcataggtttatcgaaactttcagttaaacctccgtatcattctgaattttcctagatattg |
1142 |
T |
 |
| Q |
218 |
atccgtt--acgttcttcactctccagatagacatgtcattttctgtatacatgtgtttc |
275 |
Q |
| |
|
||| ||| |||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1143 |
atctgttacacgttcttcattctccagattgacatgtcattttctgtatacatgtgtttc |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University