View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_low_17 (Length: 282)
Name: NF18249_low_17
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 263
Target Start/End: Original strand, 46366550 - 46366805
Alignment:
| Q |
8 |
tgagatgaaggcaaagacaaaagaacccaacatcctcgaagtgggggtgtggtatagggtgcaatgtagtagtacaaaatgtgcgatatattgggatgtg |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366550 |
tgagaagaaggcaaagacaaaagaacccaacatcctcgaagtgggggtgtggtatagggtgcaatgtagtagtacaaaatgtgcgatatattgggatgtg |
46366649 |
T |
 |
| Q |
108 |
tttgtcactttgttgtgttttgtggaagagaaggtcccaccacacgcacttgctctttctttggttgcttgggaagactcaccccaccactaccaagcat |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366650 |
tttgtcaccttgttgtgttttgtggaagagaaggtcccaccacacgcacttgctctttctttggttgcttgggaagactcaccccaccactaccaagcat |
46366749 |
T |
 |
| Q |
208 |
catcaatctcaaacatgccctttctttgtccacaaccacgaccatagtgtgaaaca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46366750 |
catcaatctcaaacatgccctttctttgtccacaaccacgaccatagtgtgaaaca |
46366805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University