View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_low_22 (Length: 229)
Name: NF18249_low_22
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 2179995 - 2179800
Alignment:
| Q |
17 |
agaagaagttgaagaagacaaccattgacattggttcaaggttaaggttgtacttgcagaggccattgtttgttgtaagtgcaaaggttctagttttttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2179995 |
agaagaagttgaagaagacaaccattgacattggttcaaggttaaggttgtacttgcagaggccattgtttgttgtaagtgcaaaggttctag--ttttc |
2179898 |
T |
|
| Q |
117 |
tgaaaatacgacatgtgggtttagtggaagatttatcagaggcttatcctttgcatgtcccgaaattttactccaacgtggaaacaacacgtaataaa |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2179897 |
tgaaaatacgacatgtgggtttagtcgaagatttatcaaaggcttatcctttgcatgtcccgaaattttactccaacgtggaaacaacacgtaataaa |
2179800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University